rs25405 chr20:5119342 T>C
- Sequence
ctggcactgcggaaaaacccttga[T/C]tttcccgccaccacccgctttgtg
- ASB in cell types
- HEK293 (embryonic kidney) HEK293T (embryonic kidney) GM12878 (female B-cells) breast tumor tissue
- ASB for transcription factors
- ESR1_HUMAN IKZF2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | 2.06 | -1.74 | 2.00 | n/a | No Hit | |||
| IKZF2_HUMAN | n/a | 1.66 | 1.33 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid