rs25410 chr15:26867015 A>G
- Sequence
cctccccctccgcccagctcggcc[A/G]agggcgcatttgctgagcgtctgg
- ASB in cell types
- A549 (lung carcinoma) NB69 (neuroblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | 1.37 | -1.52 | 5.00 | |||
| NB69 (neuroblastoma) | 1.52 | -1.84 | 1.50 |
Items per page:
1 – 2 of 2