rs2559643 chr12:104644178 G>T
- Sequence
ctcagaggctgctgggaaatctct[G/T]ccgcagccaccctcccagcgtgca
- ASB in cell types
- periferal blood macrophages GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| periferal blood macrophages | -1.77 | 2.15 | 2.50 | |||
| GM12878 (female B-cells) | -0.05 | 0.57 | 1.27 |
Items per page:
1 – 2 of 2