rs2561537 chr19:40687675 A>G
- Sequence
agtgacagctatgtttcctcaggc[A/G]cccgcccaagatactgacgtcaca
- ASB in cell types
- R3/R4 erythroid cells
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| R3/R4 erythroid cells | 1.57 | n/a | 1.33 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, college completion, comorbid depressive syndrome and alcohol dependence, hdl cholesterol, ldl cholesterol change with statins, mitral annular calcium, rheumatoid arthritis, triglycerides, years of education
GTEx eQTL Artery_Aorta, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Sun_Exposed_Lower_leg, Stomach