rs2562354 chr5:16899395 G>C
- Sequence
acgcctgtaatcccggcacttcgg[G/C]aggtggaggcgggcagatcacctg
- ASB in cell types
- HEK293 (embryonic kidney) keratinocytes
- ASB for transcription factors
- SNAI2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SNAI2_HUMAN | -1.50 | 1.67 | 1.33 | 4.95 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
