rs2564978 chr1:207321071 T>C
- Sequence
caatgttcactccctactgtgtta[T/C]tcaacctgtttccccaggtctctg
- ASB in cell types
- GM12878 (female B-cells) CD14+ monocytes OCI-LY7 (diffuse large B-cell lymphoma) esophagus squamous epithelium
- ASB for transcription factors
- FOXK2_HUMAN STAT1_HUMAN ESR1_HUMAN EP300_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXK2_HUMAN | n/a | 2.55 | 1.33 | n/a | n/a | |||
| STAT1_HUMAN | -2.84 | 2.94 | 2.50 | n/a | No Hit | |||
| ESR1_HUMAN | n/a | 2.40 | 2.50 | n/a | No Hit | |||
| EP300_HUMAN | -0.28 | 0.84 | 1.39 | n/a | n/a |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, advanced age-related macular degeneration (geographic atrophy), aspirin-intolerant asthma, h1n1 influenza a virus infection, myopia, neuroticism, parkinsons disease, refractive error
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Hypothalamus, Breast_Mammary_Tissue, Esophagus_Mucosa, Esophagus_Muscularis, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Thyroid, Whole_Blood