rs256655 chr12:30796577 T>C
- Sequence
tggggaccatgcctaggagagtaa[T/C]ctgagctggggactgggctctcct
- ASB in cell types
- HEK293 (embryonic kidney) K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.98 | -0.19 | 2.01 | |||
| K562 (myelogenous leukemia) | -0.30 | 1.05 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), ldl cholesterol, ldl cholesterol change with statins, prop taste detection threshold, total cholesterol change with statins
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Brain_Cortex, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg