rs2570287 chr10:17684071 G>A
- Sequence
cttcactgtggcctcatctctgac[G/A]actgtgtgagcgttggatctcttt
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.66 | -0.28 | 1.97 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP abnormal involuntary movement scale, adiponectin levels, barnes akathisia rating scale, tardive dyskinesia, total cholesterol change with statins
GTEx eQTL Artery_Tibial, Brain_Cerebellum, Brain_Spinal_cord_cervical_c-1, Colon_Sigmoid, Heart_Atrial_Appendage, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Spleen, Thyroid