rs25800 chr5:157257081 A>G
- Sequence
aatggttaccattcatctactatg[A/G]ctctttgttaggtacatgatctaa
- ASB in cell types
- coronary artery smooth muscle
- ASB for transcription factors
- JUND_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| JUND_HUMAN | 1.69 | -1.72 | 1.33 | -3.63 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
