rs258324 chr16:89687847 T>G
- Sequence
ggggaattaaggcgggaaagggag[T/G]ttgagactaggccatcagtgagtg
- ASB in cell types
- HepG2 (hepatoblastoma) HEK293 (embryonic kidney) K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | -0.28 | 0.77 | 1.99 | |||
| HEK293 (embryonic kidney) | 0.03 | 0.56 | 1.69 | |||
| K562 (myelogenous leukemia) | n/a | 1.76 | 2.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), eye color, fasting insulin, hair color (black versus red), hair color (red), hdl cholesterol, homa-ir, major depressive disorder, neuroblastoma (brain cancer), paternal transmission distortion, primary rhegmatogenous retinal detachment, total cholesterol, triglycerides
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Amygdala, Brain_Cerebellar_Hemisphere, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood