rs2586502 chr17:50211709 C>A
- Sequence
accttgccaaagaccactctgact[C/A]tgccctaaggctctttctgagttt
- ASB in cell types
- cranial neural crest cells
- ASB for transcription factors
- AP2A_HUMAN COT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| AP2A_HUMAN | n/a | 2.66 | 2.00 | 0.92 | Weak Concordant | |||
| COT1_HUMAN | n/a | 2.33 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP arthritis including non-rheumatoid, comorbid depressive syndrome and alcohol dependence, docetaxel response in lymphoblastoid cell lines, longstanding arthritis, schizophrenia