rs2587540 chr1:234701196 G>T
- Sequence
ctgtgtgtgtgtgtgtgtgtgtgt[G/T]tgtttgtgtgtgtgtgtgtgtgac
- ASB in cell types
- HEK293 (embryonic kidney) GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 1.55 | -0.70 | 3.64 | |||
| GM12878 (female B-cells) | 1.14 | 0.21 | 1.33 |
Items per page:
1 – 2 of 2