rs258790 chr5:143162412 T>C
- Sequence
catgacagcacttaaaatgttcag[T/C]tgtcacagtgaaaataaactggca
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.74 | -0.44 | 1.98 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP birth weight, diabetic retinopathy in type 2 diabetes mellitus, diastolic blood pressure (dbp), height, hip bone mineral density (bmd), homa-b, infant head circumference, spine bone mineral density (bmd), stabilized warfarin dose, systolic blood pressure (sbp), urinary albumin-to-creatinine ratio