rs2592394 chr2:176127051 A>G
- Sequence
cactgattagaatatcctaggcat[A/G]caggagctcctgcttgctgctctt
- ASB in cell types
- LNCaP (prostate carcinoma) PANC1 (pancreatic ductal adenocarcinoma) thyroid gland
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LNCaP (prostate carcinoma) | 1.84 | -0.88 | 2.00 | |||
| PANC1 (pancreatic ductal adenocarcinoma) | n/a | 2.15 | 2.00 | |||
| thyroid gland | -0.72 | 1.44 | 1.33 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP ldl cholesterol change with statins, obesity with early age of onset (age >2), serum magnesium, total cholesterol change with statins
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Hippocampus, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Lung, Muscle_Skeletal, Nerve_Tibial, Ovary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid