rs259422 chr6:146771166 G>A
- Sequence
ttcccttgttgtggttgcacaggc[G/A]gttggctttggcaatcacttcctt
- ASB in cell types
- upper lobe of left lung fetal bone marrow-derived mononuclear cells TSU-1621-MT (adult acute myeloid leukemia)
- ASB for transcription factors
- ERG_HUMAN EP300_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ERG_HUMAN | -1.60 | 1.95 | 1.33 | n/a | No Hit | |||
| EP300_HUMAN | 0.26 | 1.17 | 1.39 | n/a | n/a |
Items per page:
1 – 2 of 2