rs2595372 chr18:31658394 C>A
- Sequence
cctcccctggctgagcccgatcta[C/A]agggagtgtgaaagtacaccaggg
- ASB for transcription factors
- HTF4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| HTF4_HUMAN | 0.24 | 1.57 | 1.56 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, homa-b, hypertension (early onset hypertension), neuroblastoma (brain cancer), treatment outcomes for selective serotonin reuptake inhibitors (ssris) - response at 8 weeks, treatment outcomes for selective serotonin reuptake inhibitors (ssris) - response at last visit