rs2596912 chr3:9397062 C>T
- Sequence
taagcggctgcgtactcccgacgg[C/T]gtaactgacaggagctttactcca
- ASB in cell types
- HEK293 (embryonic kidney) A549 (lung carcinoma) breast tumor tissue CD14+ monocytes
- ASB for transcription factors
- ESR1_HUMAN JUN_HUMAN STAT1_HUMAN WT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | -1.66 | 2.03 | 2.00 | n/a | No Hit | |||
| JUN_HUMAN | -0.09 | 0.95 | 1.95 | n/a | No Hit | |||
| STAT1_HUMAN | -2.37 | 2.09 | 2.50 | n/a | No Hit | |||
| WT1_HUMAN | -2.04 | 1.83 | 1.50 | n/a | No Hit | |||
| HIC1_HUMAN | n/a | 2.21 | 2.00 | n/a | No Hit |
Items per page:
1 – 5 of 5
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Frontal_Cortex_BA9, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid, Whole_Blood