rs260502 chr19:58279418 G>A
- Sequence
gggtcggtcattcccgagagaatc[G/A]agcaggcccatctcctgcgttctg
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney) MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- ENL_HUMAN NRF1_HUMAN ZBT26_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ENL_HUMAN | 2.33 | -0.36 | 1.78 | n/a | n/a | |||
| NRF1_HUMAN | 0.75 | 0.32 | 1.96 | -2.07 | Concordant | |||
| ZBT26_HUMAN | 2.11 | -2.38 | 1.33 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Nucleus_accumbens_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Ovary, Pancreas, Prostate, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid