rs2608912 chr6:131548643 T>C
- Sequence
tcctcagcgtcataggtgaaaata[T/C]taaacagcactagatgttccaaac
- ASB in cell types
- VCaP (prostate carcinoma) CWR22 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| VCaP (prostate carcinoma) | -0.38 | 0.78 | 2.08 | |||
| CWR22 (prostate carcinoma) | -0.26 | 0.98 | 1.50 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP biploar disorder (bipolar schizoaffective disorder), body mass index (bmi), bronchodilator response in asthma, fasting blood glucose, ldl cholesterol, lp-pla2 activity, obesity with early age of onset (age >2), total cholesterol
GTEx eQTL Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Whole_Blood