rs261274 chr15:58328496 A>C
- Sequence
taatttccattgtagagatctttc[A/C]tttgttaaatgtatttctagatat
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.43 | 0.72 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, chronic kidney disease, hdl cholesterol, total cholesterol, triglycerides, urinary albumin-to-creatinine ratio