rs262421 chr11:36016809 C>T
- Sequence
atacatattgttttccaacttgct[C/T]tttcccttctgactctattgtggc
- ASB in cell types
- T47D (invasive ductal carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| T47D (invasive ductal carcinoma) | 0.96 | 0.20 | 1.47 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP child behavior checklist dysregulation profile in children with attention deficit/hyperactivity disorder (adhd), obesity with early age of onset (age >2), premature ovarian failure