rs2625336 chr11:19939251 A>T
- Sequence
gtcaggagaattttggggtggggg[A/T]gctgttaatagagtcatctttatg
- ASB in cell types
- GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 0.63 | -0.01 | 1.31 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP breast cancer, diastolic blood pressure (dbp), fasting insulin, height, homa-b, homa-ir, infant head circumference, microalbuminuria, rheumatoid arthritis, urinary albumin-to-creatinine ratio