rs262902 chr6:37148302 G>T
- Sequence
agtgagccttggttgtgtacataa[G/T]gaatttcactatctttaccttgtg
- ASB in cell types
- HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | -0.07 | 0.89 | 2.01 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP college completion, hdl cholesterol, irritible bowel syndrome, lymphocyte count, maternal transmission distortion, mitral annular calcium, nicotine dependence (smoking), paternal transmission distortion, transmission distortion