rs263095 chr11:35952012 G>T
- Sequence
ttcggctcttatatacctacccat[G/T]cttttaaaaacagctttctggtgt
- ASB in cell types
- LNCaP (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LNCaP (prostate carcinoma) | 1.05 | -0.07 | 1.44 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), bipolar disorder, irritible bowel syndrome, longstanding arthritis, waist hip ratio