rs263493 chr1:86755868 G>A
- Sequence
accttgcaacttgaggcaaaaagt[G/A]aaagaataatagctgcagtaactt
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney) monocyte-derived macrophages
- ASB for transcription factors
- SPI1_HUMAN PKNX1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 1.74 | 0.81 | 2.25 | n/a | No Hit | |||
| PKNX1_HUMAN | 1.56 | -0.82 | 1.67 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid