rs263533 chr1:2232129 C>T
- Sequence
tggccgccgttggctcctcccact[C/T]gtgtcttgacagcttattctcggg
- ASB in cell types
- K562 (myelogenous leukemia) periferal blood macrophages
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.47 | 0.38 | 1.33 | |||
| periferal blood macrophages | -0.06 | 1.73 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP height, ldl cholesterol, parkinsons disease, refractive error, serum creatinine, total cholesterol, triglycerides
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Breast_Mammary_Tissue, Esophagus_Muscularis, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Whole_Blood