rs2645107 chr6:37966105 G>A
- Sequence
gatcctttacacaaccgcaaacca[G/A]actgcatggtttgtagacaaaggg
- ASB in cell types
- GM12878 (female B-cells)
- ASB for transcription factors
- IKZF2_HUMAN IKZF1_HUMAN MEF2B_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| IKZF2_HUMAN | 1.94 | -0.69 | 1.33 | n/a | n/a | |||
| IKZF1_HUMAN | 1.84 | -0.96 | 1.33 | n/a | No Hit | |||
| MEF2B_HUMAN | 1.94 | -1.84 | 1.33 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP infant head circumference, microalbuminuria, mitral annular calcium, total cholesterol, urinary albumin-to-creatinine ratio
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Brain_Caudate_basal_ganglia, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Heart_Atrial_Appendage, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg