rs2645415 chr8:11864537 A>G
- Sequence
atgcatgaacaaaaaaatgtgcag[A/G]agaatccaaaagaggggcagcaga
- ASB in cell types
- HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.82 | -0.17 | 1.84 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP height, ldl cholesterol, parkinsons disease, refractive error, serum creatinine, simpson-angus scale, triglycerides, waist hip ratio
GTEx eQTL Artery_Aorta, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Heart_Atrial_Appendage, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood