rs2647404 chr6:75749789 G>A
- Sequence
aacacgcttaaaattcagtgcagg[G/A]ggagcgcagtttgctctgagatgt
- ASB in cell types
- K562 (myelogenous leukemia) MCF7 (Invasive ductal breast carcinoma) MCF-7L (invasive ductal carcinoma)
- ASB for transcription factors
- RING2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RING2_HUMAN | 2.03 | -1.64 | 1.78 | n/a | n/a |
Items per page:
1 – 1 of 1