rs2649191 chr3:65785241 G>C
- Sequence
ttttaagaagtatttgtaggagaa[G/C]catatataaccacaagagggcgct
- ASB in cell types
- foreskin keratinocyte AG09319 (fibroblasts) epidermal keratinocytes
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | n/a | 0.64 | 2.33 | |||
| AG09319 (fibroblasts) | 1.90 | -1.70 | 1.33 | |||
| epidermal keratinocytes | 1.38 | -0.45 | 2.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, systolic blood pressure (sbp), triglycerides