rs265179 chr5:139985867 C>G
- Sequence
tcagggcaattatccacactcccc[C/G]caactcccaatgacccactgggag
- ASB in cell types
- HCT-116 (colon carcinoma) MCF7 (Invasive ductal breast carcinoma) monocyte-derived dendritic cells
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HCT-116 (colon carcinoma) | -0.38 | 1.15 | 1.33 | |||
| MCF7 (Invasive ductal breast carcinoma) | -1.85 | 1.67 | 1.33 | |||
| monocyte-derived dendritic cells | n/a | 2.45 | 2.50 |
Items per page:
1 – 3 of 3