rs265296 chr19:1508739 G>A
- Sequence
aggactggaccgtaggtgctctgc[G/A]tccagcaacctgggactcgcaggc
- ASB in cell types
- HEK293 (embryonic kidney) K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.69 | -0.15 | 1.99 | |||
| K562 (myelogenous leukemia) | -0.26 | 0.68 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adrenal_Gland, Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cortex, Brain_Frontal_Cortex_BA9, Esophagus_Mucosa, Esophagus_Muscularis, Liver, Testis, Thyroid