rs265303 chr11:130309530 T>C
- Sequence
aatgtgttatctccactgatcaca[T/C]atccaaatgcctttttatctgtac
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- MTG16_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MTG16_HUMAN | -2.29 | 2.36 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP abnormal involuntary movement scale, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, barnes akathisia rating scale, cystatin c in serum, hypertension (early onset hypertension), schizophrenia, tardive dyskinesia