rs265419 chr5:115209312 A>T
- Sequence
aggtacacagcgtaaaacccagac[A/T]gctctaatgcaatcagcagacctt
- ASB in cell types
- GM12878 (female B-cells) myoblasts
- ASB for transcription factors
- SKIL_HUMAN DUX4_HUMAN IKZF1_HUMAN PKNX1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SKIL_HUMAN | 1.29 | -1.21 | 1.00 | n/a | n/a | |||
| DUX4_HUMAN | 1.85 | -1.65 | 1.33 | n/a | No Hit | |||
| IKZF1_HUMAN | 1.00 | -0.69 | 1.33 | n/a | No Hit | |||
| PKNX1_HUMAN | 1.68 | -1.31 | 1.33 | n/a | No Hit |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Frontal_Cortex_BA9, Brain_Nucleus_accumbens_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Muscle_Skeletal, Nerve_Tibial, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid