rs265556 chr19:17784471 A>C
- Sequence
tcccctgttgcagatagtatgttt[A/C]tgtgaactagaagcagcccagccc
- ASB in cell types
- GM12878 (female B-cells) KMS-11
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 0.35 | 0.79 | 1.27 | |||
| KMS-11 | 2.10 | -1.93 | 2.00 |
Items per page:
1 – 2 of 2