rs2660849 chr12:96046947 T>C
- Sequence
tcagagacagaacattaccaccac[T/C]gcactgttgcctcccttaagttcc
- ASB in cell types
- HEK293 (embryonic kidney) T47D (invasive ductal carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.62 | -0.47 | 1.98 | |||
| T47D (invasive ductal carcinoma) | 0.88 | -0.10 | 1.44 |
Items per page:
1 – 2 of 2