rs2665391 chr17:59784142 T>A
- Sequence
tgtgtgtgtgtgtgtgtgtgtgtg[T/A]gagagagagagagagattggaggg
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | -0.94 | 0.98 | 2.59 | |||
| HEK293 (embryonic kidney) | 0.66 | 0.59 | 1.68 |
Items per page:
1 – 2 of 2