rs266650 chr12:54759867 A>T
- Sequence
agggtatgtttgctatggggtaat[A/T]tttagctgcctgttggtctcctta
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney) erythroid cells PANC1 (pancreatic ductal adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.55 | -0.26 | 2.01 | |||
| HEK293 (embryonic kidney) | 0.75 | -0.02 | 1.96 | |||
| erythroid cells | n/a | 1.76 | 2.00 | |||
| PANC1 (pancreatic ductal adenocarcinoma) | -2.88 | 2.29 | 2.00 | |||
| IPSC-derived bipolar neuron | 0.77 | -0.69 | 1.00 |
Items per page:
1 – 5 of 5