rs267307 chr5:115262507 C>T
- Sequence
gaaaaagccggaaactggagatgc[C/T]acagccctcgacctacagccttcc
- ASB in cell types
- GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 0.60 | 0.47 | 1.27 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP amyotrophic lateral sclerosis (als) age of onset, birth weight, fasting blood glucose, height, hip bone mineral density (bmd), homa-b, neuroblastoma (brain cancer), rheumatoid arthritis, spine bone mineral density (bmd), tourettes syndrome
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Muscle_Skeletal, Thyroid, Whole_Blood