rs267734 chr1:150979001 T>C
- Sequence
gaaaaggtggtagattagatcctc[T/C]ctaagatttcctccaactctgcaa
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.17 | 0.76 | 2.09 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
EMBL-EBI chronic kidney disease, glomerular filtration rate (creatinine), glomerular filtration rate in non diabetics (creatinine)
GRASP body mass index (bmi), chronic kidney disease, cystatin c in serum, fasting blood glucose, hdl cholesterol, homa-b, ldl cholesterol, plasma beta-2 microglobulin levels, plasma beta-trace protein levels, presence of peripupillary pigmented ring, serum creatinine, serum creatinine estimated glomerular filtration rate (egfr), serum creatinine estimated glomerular filtration rate (egfr) (females), serum creatinine estimated glomerular filtration rate (egfr) (no diabetes), serum creatinine estimated glomerular filtration rate (egfr) (no hypertension), serum creatinine estimated glomerular filtration rate (egfr) (with hypertension), serum creatinine estimated glomerular filtration rate (egfr) age <65, serum creatinine estimated glomerular filtration rate (egfr) age >65, serum creatinine estimated glomerular filtration rate (egfr) with hypertension, serum creatinine estimated glomerular filtration rate (egfr) without diabetes, serum creatinine estimated glomerular filtration rate (egfr) without hypertension, serum cystatin c estimated glomerular filtration rate (egfr), waist hip ratio
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid, Whole_Blood