rs2677934 chr5:6519438 C>T
- Sequence
aaaatacagactgcccagtcaaag[C/T]tgaatttcagataaacagcgagtg
- ASB in cell types
- VCaP (prostate carcinoma) embryonic kidney
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| VCaP (prostate carcinoma) | 1.21 | 0.03 | 2.00 | |||
| embryonic kidney | -2.87 | 2.28 | 3.00 |
Items per page:
1 – 2 of 2