rs2678120 chr12:42757152 T>C
- Sequence
acatatttgtaagacaaagcaatg[T/C]tgtggcctaccaggaggcctatga
- ASB in cell types
- coronary artery smooth muscle MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| coronary artery smooth muscle | -1.03 | 1.37 | 1.33 | |||
| MCF7 (Invasive ductal breast carcinoma) | 0.26 | 0.47 | 1.61 |
Items per page:
1 – 2 of 2