rs2682299 chr12:52907275 A>C
- Sequence
cccaccagggctgagaagctttta[A/C]cagaagaccaaagggagaaggact
- ASB in cell types
- K562 (myelogenous leukemia) MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.08 | 0.77 | 1.96 | |||
| MCF7 (Invasive ductal breast carcinoma) | -1.52 | 1.31 | 1.33 |
Items per page:
1 – 2 of 2