rs2682300 chr12:52907274 A>T
- Sequence
acccaccagggctgagaagctttt[A/T]acagaagaccaaagggagaaggac
- ASB in cell types
- K562 (myelogenous leukemia) MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.06 | 0.78 | 1.97 | |||
| MCF7 (Invasive ductal breast carcinoma) | -1.59 | 1.37 | 1.33 |
Items per page:
1 – 2 of 2