rs268739 chr5:33300208 C>T
- Sequence
catattctgatcgttttctatagg[C/T]aatgaaaggcataatctttctttc
- ASB in cell types
- periferal blood macrophages HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| periferal blood macrophages | 1.33 | -1.00 | 2.00 | |||
| HEK293 (embryonic kidney) | 0.76 | -0.65 | 2.91 |
Items per page:
1 – 2 of 2