rs2693368 chr17:45577286 C>A
- Sequence
ccagcctaaccaatctatctcatt[C/A]aggattcattctaatgcctgaatt
- ASB in cell types
- GM12878 (female B-cells) K562 (myelogenous leukemia) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | -0.31 | 1.01 | 1.56 | |||
| K562 (myelogenous leukemia) | -0.05 | 0.53 | 2.00 | |||
| HEK293 (embryonic kidney) | 0.30 | 0.35 | 1.70 |
Items per page:
1 – 3 of 3