rs2695097 chr2:177906229 A>C
- Sequence
acaatggtgccctaggaagaggta[A/C]caagcgctggcaaaatagagcaat
- ASB in cell types
- erythroid progenitors epidermal keratinocytes
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| erythroid progenitors | -3.43 | 2.16 | 2.50 | |||
| epidermal keratinocytes | -1.83 | 1.90 | 2.00 |
Items per page:
1 – 2 of 2