rs269767 chr5:140157337 A>G
- Sequence
ggacctaatagacgatgccgcagc[A/G]gcccagcctccagcgtctggggta
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) foreskin keratinocyte GM12878 (female B-cells) OCI-LY7 (diffuse large B-cell lymphoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | -0.17 | 1.27 | 2.62 | |||
| foreskin keratinocyte | n/a | 0.55 | 2.50 | |||
| GM12878 (female B-cells) | 0.41 | 0.62 | 1.29 | |||
| OCI-LY7 (diffuse large B-cell lymphoma) | 1.03 | -0.66 | 1.11 | |||
| epidermal keratinocytes | -1.04 | 1.81 | 2.00 |
Items per page:
1 – 5 of 6
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Cerebellar_Hemisphere, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Muscle_Skeletal, Nerve_Tibial, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis