rs2704638 chr2:205293593 G>A
- Sequence
taagttaagcaaaaggaacaacta[G/A]tatgcaaagaaaggcaaaatacag
- ASB in cell types
- monocyte-derived dendritic cells monocyte-derived macrophages
- ASB for transcription factors
- TF65_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TF65_HUMAN | n/a | 1.90 | 2.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP abnormal involuntary movement scale, hdl cholesterol, major depressive disorder, obesity with early age of onset (age >2), rheumatoid arthritis