rs2705001 chr7:106365391 A>G
- Sequence
ccaagtcacaagccacgtctacta[A/G]gggaatgacacaacattatgaaac
- ASB in cell types
- CD14+ monocytes monocyte-derived macrophages
- ASB for transcription factors
- STAT1_HUMAN TF65_HUMAN GRHL2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | 1.39 | -3.74 | 2.50 | n/a | No Hit | |||
| TF65_HUMAN | 1.66 | n/a | 2.50 | n/a | No Hit | |||
| GRHL2_HUMAN | 1.12 | 0.06 | 1.50 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP cystatin c in serum, hdl cholesterol, ldl cholesterol, ldl cholesterol change with statins, suicide attempts in bipolar disorder (substance abuse/dependence), total cholesterol, total cholesterol change with statins, years of education